Source code for glow.functions

# Copyright 2019 The Glow Authors
# 
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
# 
#     http://www.apache.org/licenses/LICENSE-2.0
# 
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.


# The Glow Python functions
# Note that this file is generated from the definitions in functions.yml.

from pyspark import SparkContext
from pyspark.sql.column import Column, _to_java_column, _to_seq
from typeguard import check_argument_types, check_return_type
from typing import Union

def sc():
    return SparkContext._active_spark_context

########### complex_type_manipulation

[docs]def add_struct_fields(struct: Union[Column, str], *fields: Union[Column, str]) -> Column: """ Adds fields to a struct. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(struct=Row(a=1))]) >>> df.select(glow.add_struct_fields('struct', lit('b'), lit(2)).alias('struct')).collect() [Row(struct=Row(a=1, b=2))] Args: struct : The struct to which fields will be added fields : The new fields to add. The arguments must alternate between string-typed literal field names and field values. Returns: A struct consisting of the input struct and the added fields """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.add_struct_fields(_to_java_column(struct), _to_seq(sc(), fields, _to_java_column))) assert check_return_type(output) return output
[docs]def array_summary_stats(arr: Union[Column, str]) -> Column: """ Computes the minimum, maximum, mean, standard deviation for an array of numerics. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(arr=[1, 2, 3])]) >>> df.select(glow.expand_struct(glow.array_summary_stats('arr'))).collect() [Row(mean=2.0, stdDev=1.0, min=1.0, max=3.0)] Args: arr : An array of any numeric type Returns: A struct containing double ``mean``, ``stdDev``, ``min``, and ``max`` fields """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.array_summary_stats(_to_java_column(arr))) assert check_return_type(output) return output
[docs]def array_to_dense_vector(arr: Union[Column, str]) -> Column: """ Converts an array of numerics into a ``spark.ml`` ``DenseVector``. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import DenseVector >>> df = spark.createDataFrame([Row(arr=[1, 2, 3])]) >>> df.select(glow.array_to_dense_vector('arr').alias('v')).collect() [Row(v=DenseVector([1.0, 2.0, 3.0]))] Args: arr : The array of numerics Returns: A ``spark.ml`` ``DenseVector`` """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.array_to_dense_vector(_to_java_column(arr))) assert check_return_type(output) return output
[docs]def array_to_sparse_vector(arr: Union[Column, str]) -> Column: """ Converts an array of numerics into a ``spark.ml`` ``SparseVector``. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import SparseVector >>> df = spark.createDataFrame([Row(arr=[1, 0, 2, 0, 3, 0])]) >>> df.select(glow.array_to_sparse_vector('arr').alias('v')).collect() [Row(v=SparseVector(6, {0: 1.0, 2: 2.0, 4: 3.0}))] Args: arr : The array of numerics Returns: A ``spark.ml`` ``SparseVector`` """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.array_to_sparse_vector(_to_java_column(arr))) assert check_return_type(output) return output
[docs]def expand_struct(struct: Union[Column, str]) -> Column: """ Promotes fields of a nested struct to top-level columns similar to using ``struct.*`` from SQL, but can be used in more contexts. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(struct=Row(a=1, b=2))]) >>> df.select(glow.expand_struct(col('struct'))).collect() [Row(a=1, b=2)] Args: struct : The struct to expand Returns: Columns corresponding to fields of the input struct """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.expand_struct(_to_java_column(struct))) assert check_return_type(output) return output
[docs]def explode_matrix(matrix: Union[Column, str]) -> Column: """ Explodes a ``spark.ml`` ``Matrix`` (sparse or dense) into multiple arrays, one per row of the matrix. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import DenseMatrix >>> m = DenseMatrix(numRows=3, numCols=2, values=[1, 2, 3, 4, 5, 6]) >>> df = spark.createDataFrame([Row(matrix=m)]) >>> df.select(glow.explode_matrix('matrix').alias('row')).collect() [Row(row=[1.0, 4.0]), Row(row=[2.0, 5.0]), Row(row=[3.0, 6.0])] Args: matrix : The ``sparl.ml`` ``Matrix`` to explode Returns: An array column in which each row is a row of the input matrix """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.explode_matrix(_to_java_column(matrix))) assert check_return_type(output) return output
[docs]def subset_struct(struct: Union[Column, str], *fields: str) -> Column: """ Selects fields from a struct. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(struct=Row(a=1, b=2, c=3))]) >>> df.select(glow.subset_struct('struct', 'a', 'c').alias('struct')).collect() [Row(struct=Row(a=1, c=3))] Args: struct : Struct from which to select fields fields : Fields to select Returns: A struct containing only the indicated fields """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.subset_struct(_to_java_column(struct), _to_seq(sc(), fields))) assert check_return_type(output) return output
[docs]def vector_to_array(vector: Union[Column, str]) -> Column: """ Converts a ``spark.ml`` ``Vector`` (sparse or dense) to an array of doubles. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import DenseVector, SparseVector >>> df = spark.createDataFrame([Row(v=SparseVector(3, {0: 1.0, 2: 2.0})), Row(v=DenseVector([3.0, 4.0]))]) >>> df.select(glow.vector_to_array('v').alias('arr')).collect() [Row(arr=[1.0, 0.0, 2.0]), Row(arr=[3.0, 4.0])] Args: vector : Vector to convert Returns: An array of doubles """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.vector_to_array(_to_java_column(vector))) assert check_return_type(output) return output
########### etl
[docs]def hard_calls(probabilities: Union[Column, str], numAlts: Union[Column, str], phased: Union[Column, str], threshold: float = None) -> Column: """ Converts an array of probabilities to hard calls. The probabilities are assumed to be diploid. See :ref:`variant-data-transformations` for more details. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(probs=[0.95, 0.05, 0.0])]) >>> df.select(glow.hard_calls('probs', numAlts=lit(1), phased=lit(False)).alias('calls')).collect() [Row(calls=[0, 0])] >>> df = spark.createDataFrame([Row(probs=[0.05, 0.95, 0.0])]) >>> df.select(glow.hard_calls('probs', numAlts=lit(1), phased=lit(False)).alias('calls')).collect() [Row(calls=[1, 0])] >>> # Use the threshold parameter to change the minimum probability required for a call >>> df = spark.createDataFrame([Row(probs=[0.05, 0.95, 0.0])]) >>> df.select(glow.hard_calls('probs', numAlts=lit(1), phased=lit(False), threshold=0.99).alias('calls')).collect() [Row(calls=[-1, -1])] Args: probabilities : The array of probabilities to convert numAlts : The number of alternate alleles phased : Whether the probabilities are phased. If phased, we expect one ``2 * numAlts`` values in the probabilities array. If unphased, we expect one probability per possible genotype. threshold : The minimum probability to make a call. If no probability falls into the range of ``[0, 1 - threshold]`` or ``[threshold, 1]``, a no-call (represented by ``-1`` s) will be emitted. If not provided, this parameter defaults to ``0.9``. Returns: An array of hard calls """ assert check_argument_types() if threshold is None: output = Column(sc()._jvm.io.projectglow.functions.hard_calls(_to_java_column(probabilities), _to_java_column(numAlts), _to_java_column(phased))) else: output = Column(sc()._jvm.io.projectglow.functions.hard_calls(_to_java_column(probabilities), _to_java_column(numAlts), _to_java_column(phased), threshold)) assert check_return_type(output) return output
[docs]def lift_over_coordinates(contigName: Union[Column, str], start: Union[Column, str], end: Union[Column, str], chainFile: str, minMatchRatio: float = None) -> Column: """ Performs liftover for the coordinates of a variant. To perform liftover of alleles and add additional metadata, see :ref:`liftover`. Added in version 0.3.0. Examples: >>> df = spark.read.format('vcf').load('test-data/liftover/unlifted.test.vcf').where('start = 18210071') >>> chain_file = 'test-data/liftover/hg38ToHg19.over.chain.gz' >>> reference_file = 'test-data/liftover/hg19.chr20.fa.gz' >>> df.select('contigName', 'start', 'end').head() Row(contigName='chr20', start=18210071, end=18210072) >>> lifted_df = df.select(glow.expand_struct(glow.lift_over_coordinates('contigName', 'start', 'end', chain_file))) >>> lifted_df.head() Row(contigName='chr20', start=18190715, end=18190716) Args: contigName : The current contig name start : The current start end : The current end chainFile : Location of the chain file on each node in the cluster minMatchRatio : Minimum fraction of bases that must remap to do liftover successfully. If not provided, defaults to ``0.95``. Returns: A struct containing ``contigName``, ``start``, and ``end`` fields after liftover """ assert check_argument_types() if minMatchRatio is None: output = Column(sc()._jvm.io.projectglow.functions.lift_over_coordinates(_to_java_column(contigName), _to_java_column(start), _to_java_column(end), chainFile)) else: output = Column(sc()._jvm.io.projectglow.functions.lift_over_coordinates(_to_java_column(contigName), _to_java_column(start), _to_java_column(end), chainFile, minMatchRatio)) assert check_return_type(output) return output
[docs]def normalize_variant(contigName: Union[Column, str], start: Union[Column, str], end: Union[Column, str], refAllele: Union[Column, str], altAlleles: Union[Column, str], refGenomePathString: str) -> Column: """ Normalizes the variant with a behavior similar to vt normalize or bcftools norm. Creates a StructType column including the normalized ``start``, ``end``, ``referenceAllele`` and ``alternateAlleles`` fields (whether they are changed or unchanged as the result of normalization) as well as a StructType field called ``normalizationStatus`` that contains the following fields: ``changed``: A boolean field indicating whether the variant data was changed as a result of normalization ``errorMessage``: An error message in case the attempt at normalizing the row hit an error. In this case, the ``changed`` field will be set to ``false``. If no errors occur, this field will be ``null``. In case of an error, the ``start``, ``end``, ``referenceAllele`` and ``alternateAlleles`` fields in the generated struct will be ``null``. Added in version 0.3.0. Examples: >>> df = spark.read.format('vcf').load('test-data/variantsplitternormalizer-test/test_left_align_hg38_altered.vcf') >>> ref_genome = 'test-data/variantsplitternormalizer-test/Homo_sapiens_assembly38.20.21_altered.fasta' >>> df.select('contigName', 'start', 'end', 'referenceAllele', 'alternateAlleles').head() Row(contigName='chr20', start=400, end=401, referenceAllele='G', alternateAlleles=['GATCTTCCCTCTTTTCTAATATAAACACATAAAGCTCTGTTTCCTTCTAGGTAACTGGTTTGAG']) >>> normalized_df = df.select('contigName', glow.expand_struct(glow.normalize_variant('contigName', 'start', 'end', 'referenceAllele', 'alternateAlleles', ref_genome))) >>> normalized_df.head() Row(contigName='chr20', start=268, end=269, referenceAllele='A', alternateAlleles=['ATTTGAGATCTTCCCTCTTTTCTAATATAAACACATAAAGCTCTGTTTCCTTCTAGGTAACTGG'], normalizationStatus=Row(changed=True, errorMessage=None)) Args: contigName : The current contig name start : The current start end : The current end refAllele : The current reference allele altAlleles : The current array of alternate alleles refGenomePathString : A path to the reference genome ``.fasta`` file. The ``.fasta`` file must be accompanied with a ``.fai`` index file in the same folder. Returns: A struct as explained above """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.normalize_variant(_to_java_column(contigName), _to_java_column(start), _to_java_column(end), _to_java_column(refAllele), _to_java_column(altAlleles), refGenomePathString)) assert check_return_type(output) return output
[docs]def mean_substitute(array: Union[Column, str], missingValue: Union[Column, str] = None) -> Column: """ Substitutes the missing values of a numeric array using the mean of the non-missing values. Any values that are NaN, null or equal to the missing value parameter are considered missing. See :ref:`variant-data-transformations` for more details. Added in version 0.4.0. Examples: >>> df = spark.createDataFrame([Row(unsubstituted_values=[float('nan'), None, 0.0, 1.0, 2.0, 3.0, 4.0])]) >>> df.select(glow.mean_substitute('unsubstituted_values', lit(0.0)).alias('substituted_values')).collect() [Row(substituted_values=[2.5, 2.5, 2.5, 1.0, 2.0, 3.0, 4.0])] >>> df = spark.createDataFrame([Row(unsubstituted_values=[0, 1, 2, 3, -1, None])]) >>> df.select(glow.mean_substitute('unsubstituted_values').alias('substituted_values')).collect() [Row(substituted_values=[0.0, 1.0, 2.0, 3.0, 1.5, 1.5])] Args: array : A numeric array that may contain missing values missingValue : A value that should be considered missing. If not provided, this parameter defaults to ``-1``. Returns: A numeric array with substituted missing values """ assert check_argument_types() if missingValue is None: output = Column(sc()._jvm.io.projectglow.functions.mean_substitute(_to_java_column(array))) else: output = Column(sc()._jvm.io.projectglow.functions.mean_substitute(_to_java_column(array), _to_java_column(missingValue))) assert check_return_type(output) return output
########### quality_control
[docs]def call_summary_stats(genotypes: Union[Column, str]) -> Column: """ Computes call summary statistics for an array of genotype structs. See :ref:`variant-qc` for more details. Added in version 0.3.0. Examples: >>> schema = 'genotypes: array<struct<calls: array<int>>>' >>> df = spark.createDataFrame([Row(genotypes=[Row(calls=[0, 0]), Row(calls=[1, 0]), Row(calls=[1, 1])])], schema) >>> df.select(glow.expand_struct(glow.call_summary_stats('genotypes'))).collect() [Row(callRate=1.0, nCalled=3, nUncalled=0, nHet=1, nHomozygous=[1, 1], nNonRef=2, nAllelesCalled=6, alleleCounts=[3, 3], alleleFrequencies=[0.5, 0.5])] Args: genotypes : The array of genotype structs with ``calls`` field Returns: A struct containing ``callRate``, ``nCalled``, ``nUncalled``, ``nHet``, ``nHomozygous``, ``nNonRef``, ``nAllelesCalled``, ``alleleCounts``, ``alleleFrequencies`` fields. See :ref:`variant-qc`. """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.call_summary_stats(_to_java_column(genotypes))) assert check_return_type(output) return output
[docs]def dp_summary_stats(genotypes: Union[Column, str]) -> Column: """ Computes summary statistics for the depth field from an array of genotype structs. See :ref:`variant-qc`. Added in version 0.3.0. Examples: >>> df = spark.createDataFrame([Row(genotypes=[Row(depth=1), Row(depth=2), Row(depth=3)])], 'genotypes: array<struct<depth: int>>') >>> df.select(glow.expand_struct(glow.dp_summary_stats('genotypes'))).collect() [Row(mean=2.0, stdDev=1.0, min=1.0, max=3.0)] Args: genotypes : An array of genotype structs with ``depth`` field Returns: A struct containing ``mean``, ``stdDev``, ``min``, and ``max`` of genotype depths """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.dp_summary_stats(_to_java_column(genotypes))) assert check_return_type(output) return output
[docs]def hardy_weinberg(genotypes: Union[Column, str]) -> Column: """ Computes statistics relating to the Hardy Weinberg equilibrium. See :ref:`variant-qc` for more details. Added in version 0.3.0. Examples: >>> genotypes = [ ... Row(calls=[1, 1]), ... Row(calls=[1, 0]), ... Row(calls=[0, 0])] >>> df = spark.createDataFrame([Row(genotypes=genotypes)], 'genotypes: array<struct<calls: array<int>>>') >>> df.select(glow.expand_struct(glow.hardy_weinberg('genotypes'))).collect() [Row(hetFreqHwe=0.6, pValueHwe=0.7)] Args: genotypes : The array of genotype structs with ``calls`` field Returns: A struct containing two fields, ``hetFreqHwe`` (the expected heterozygous frequency according to Hardy-Weinberg equilibrium) and ``pValueHwe`` (the associated p-value) """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.hardy_weinberg(_to_java_column(genotypes))) assert check_return_type(output) return output
[docs]def gq_summary_stats(genotypes: Union[Column, str]) -> Column: """ Computes summary statistics about the genotype quality field for an array of genotype structs. See :ref:`variant-qc`. Added in version 0.3.0. Examples: >>> genotypes = [ ... Row(conditionalQuality=1), ... Row(conditionalQuality=2), ... Row(conditionalQuality=3)] >>> df = spark.createDataFrame([Row(genotypes=genotypes)], 'genotypes: array<struct<conditionalQuality: int>>') >>> df.select(glow.expand_struct(glow.gq_summary_stats('genotypes'))).collect() [Row(mean=2.0, stdDev=1.0, min=1.0, max=3.0)] Args: genotypes : The array of genotype structs with ``conditionalQuality`` field Returns: A struct containing ``mean``, ``stdDev``, ``min``, and ``max`` of genotype qualities """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.gq_summary_stats(_to_java_column(genotypes))) assert check_return_type(output) return output
[docs]def sample_call_summary_stats(genotypes: Union[Column, str], refAllele: Union[Column, str], alternateAlleles: Union[Column, str]) -> Column: """ Computes per-sample call summary statistics. See :ref:`sample-qc` for more details. Added in version 0.3.0. Examples: >>> sites = [ ... Row(refAllele='C', alternateAlleles=['G'], genotypes=[Row(sampleId='NA12878', calls=[0, 0])]), ... Row(refAllele='A', alternateAlleles=['G'], genotypes=[Row(sampleId='NA12878', calls=[1, 1])]), ... Row(refAllele='AG', alternateAlleles=['A'], genotypes=[Row(sampleId='NA12878', calls=[1, 0])])] >>> df = spark.createDataFrame(sites, 'alternateAlleles: array<string>, genotypes: array<struct<sampleId: string, calls: array<int>>>, refAllele: string') >>> df.select(glow.sample_call_summary_stats('genotypes', 'refAllele', 'alternateAlleles').alias('stats')).collect() [Row(stats=[Row(sampleId='NA12878', callRate=1.0, nCalled=3, nUncalled=0, nHomRef=1, nHet=1, nHomVar=1, nSnp=2, nInsertion=0, nDeletion=1, nTransition=2, nTransversion=0, nSpanningDeletion=0, rTiTv=inf, rInsertionDeletion=0.0, rHetHomVar=1.0)])] Args: genotypes : An array of genotype structs with ``calls`` field refAllele : The reference allele alternateAlleles : An array of alternate alleles Returns: A struct containing ``sampleId``, ``callRate``, ``nCalled``, ``nUncalled``, ``nHomRef``, ``nHet``, ``nHomVar``, ``nSnp``, ``nInsertion``, ``nDeletion``, ``nTransition``, ``nTransversion``, ``nSpanningDeletion``, ``rTiTv``, ``rInsertionDeletion``, ``rHetHomVar`` fields. See :ref:`sample-qc`. """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.sample_call_summary_stats(_to_java_column(genotypes), _to_java_column(refAllele), _to_java_column(alternateAlleles))) assert check_return_type(output) return output
[docs]def sample_dp_summary_stats(genotypes: Union[Column, str]) -> Column: """ Computes per-sample summary statistics about the depth field in an array of genotype structs. Added in version 0.3.0. Examples: >>> sites = [ ... Row(genotypes=[Row(sampleId='NA12878', depth=1)]), ... Row(genotypes=[Row(sampleId='NA12878', depth=2)]), ... Row(genotypes=[Row(sampleId='NA12878', depth=3)])] >>> df = spark.createDataFrame(sites, 'genotypes: array<struct<depth: int, sampleId: string>>') >>> df.select(glow.sample_dp_summary_stats('genotypes').alias('stats')).collect() [Row(stats=[Row(sampleId='NA12878', mean=2.0, stdDev=1.0, min=1.0, max=3.0)])] Args: genotypes : An array of genotype structs with ``depth`` field Returns: An array of structs where each struct contains ``mean``, ``stDev``, ``min``, and ``max`` of the genotype depths for a sample. If ``sampleId`` is present in a genotype, it will be propagated to the resulting struct as an extra field. """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.sample_dp_summary_stats(_to_java_column(genotypes))) assert check_return_type(output) return output
[docs]def sample_gq_summary_stats(genotypes: Union[Column, str]) -> Column: """ Computes per-sample summary statistics about the genotype quality field in an array of genotype structs. Added in version 0.3.0. Examples: >>> sites = [ ... Row(genotypes=[Row(sampleId='NA12878', conditionalQuality=1)]), ... Row(genotypes=[Row(sampleId='NA12878', conditionalQuality=2)]), ... Row(genotypes=[Row(sampleId='NA12878', conditionalQuality=3)])] >>> df = spark.createDataFrame(sites, 'genotypes: array<struct<conditionalQuality: int, sampleId: string>>') >>> df.select(glow.sample_gq_summary_stats('genotypes').alias('stats')).collect() [Row(stats=[Row(sampleId='NA12878', mean=2.0, stdDev=1.0, min=1.0, max=3.0)])] Args: genotypes : An array of genotype structs with ``conditionalQuality`` field Returns: An array of structs where each struct contains ``mean``, ``stDev``, ``min``, and ``max`` of the genotype qualities for a sample. If ``sampleId`` is present in a genotype, it will be propagated to the resulting struct as an extra field. """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.sample_gq_summary_stats(_to_java_column(genotypes))) assert check_return_type(output) return output
########### gwas_functions
[docs]def linear_regression_gwas(genotypes: Union[Column, str], phenotypes: Union[Column, str], covariates: Union[Column, str]) -> Column: """ Performs a linear regression association test optimized for performance in a GWAS setting. See :ref:`linear-regression` for details. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import DenseMatrix >>> phenotypes = [2, 3, 4] >>> genotypes = [0, 1, 2] >>> covariates = DenseMatrix(numRows=3, numCols=1, values=[1, 1, 1]) >>> df = spark.createDataFrame([Row(genotypes=genotypes, phenotypes=phenotypes, covariates=covariates)]) >>> df.select(glow.expand_struct(glow.linear_regression_gwas('genotypes', 'phenotypes', 'covariates'))).collect() [Row(beta=0.9999999999999998, standardError=1.4901161193847656e-08, pValue=9.486373847239922e-09)] Args: genotypes : A numeric array of genotypes phenotypes : A numeric array of phenotypes covariates : A ``spark.ml`` ``Matrix`` of covariates Returns: A struct containing ``beta``, ``standardError``, and ``pValue`` fields. See :ref:`linear-regression`. """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.linear_regression_gwas(_to_java_column(genotypes), _to_java_column(phenotypes), _to_java_column(covariates))) assert check_return_type(output) return output
[docs]def logistic_regression_gwas(genotypes: Union[Column, str], phenotypes: Union[Column, str], covariates: Union[Column, str], test: str, offset: Union[Column, str] = None) -> Column: """ Performs a logistic regression association test optimized for performance in a GWAS setting. See :ref:`logistic-regression` for more details. Added in version 0.3.0. Examples: >>> from pyspark.ml.linalg import DenseMatrix >>> phenotypes = [1, 0, 0, 1, 1] >>> genotypes = [0, 0, 1, 2, 2] >>> covariates = DenseMatrix(numRows=5, numCols=1, values=[1, 1, 1, 1, 1]) >>> offset = [1, 0, 1, 0, 1] >>> df = spark.createDataFrame([Row(genotypes=genotypes, phenotypes=phenotypes, covariates=covariates, offset=offset)]) >>> df.select(glow.expand_struct(glow.logistic_regression_gwas('genotypes', 'phenotypes', 'covariates', 'Firth'))).collect() [Row(beta=0.7418937644793101, oddsRatio=2.09990848346903, waldConfidenceInterval=[0.2509874689201784, 17.569066925598555], pValue=0.3952193664793294)] >>> df.select(glow.expand_struct(glow.logistic_regression_gwas('genotypes', 'phenotypes', 'covariates', 'LRT'))).collect() [Row(beta=1.1658962684583645, oddsRatio=3.208797538802116, waldConfidenceInterval=[0.29709600522888285, 34.65674887513274], pValue=0.2943946848756769)] >>> df.select(glow.expand_struct(glow.logistic_regression_gwas('genotypes', 'phenotypes', 'covariates', 'Firth', 'offset'))).collect() [Row(beta=0.8024832156793392, oddsRatio=2.231074294047771, waldConfidenceInterval=[0.2540891981649045, 19.590334974925725], pValue=0.3754070658316332)] >>> df.select(glow.expand_struct(glow.logistic_regression_gwas('genotypes', 'phenotypes', 'covariates', 'LRT', 'offset'))).collect() [Row(beta=1.1996041727573317, oddsRatio=3.3188029900720117, waldConfidenceInterval=[0.3071189078535928, 35.863807161497334], pValue=0.2857137988674153)] Args: genotypes : An numeric array of genotypes phenotypes : A double array of phenotype values covariates : A ``spark.ml`` ``Matrix`` of covariates test : Which logistic regression test to use. Can be ``LRT`` or ``Firth`` offset : An optional double array of offset values. The offset vector is added with coefficient 1 to the linear predictor term X*b. Returns: A struct containing ``beta``, ``oddsRatio``, ``waldConfidenceInterval``, and ``pValue`` fields. See :ref:`logistic-regression`. """ assert check_argument_types() if offset is None: output = Column(sc()._jvm.io.projectglow.functions.logistic_regression_gwas(_to_java_column(genotypes), _to_java_column(phenotypes), _to_java_column(covariates), test)) else: output = Column(sc()._jvm.io.projectglow.functions.logistic_regression_gwas(_to_java_column(genotypes), _to_java_column(phenotypes), _to_java_column(covariates), test, _to_java_column(offset))) assert check_return_type(output) return output
[docs]def genotype_states(genotypes: Union[Column, str]) -> Column: """ Gets the number of alternate alleles for an array of genotype structs. Returns ``-1`` if there are any ``-1`` s (no-calls) in the calls array. Added in version 0.3.0. Examples: >>> genotypes = [ ... Row(calls=[1, 1]), ... Row(calls=[1, 0]), ... Row(calls=[0, 0]), ... Row(calls=[-1, -1])] >>> df = spark.createDataFrame([Row(genotypes=genotypes)], 'genotypes: array<struct<calls: array<int>>>') >>> df.select(glow.genotype_states('genotypes').alias('states')).collect() [Row(states=[2, 1, 0, -1])] Args: genotypes : An array of genotype structs with ``calls`` field Returns: An array of integers containing the number of alternate alleles in each call array """ assert check_argument_types() output = Column(sc()._jvm.io.projectglow.functions.genotype_states(_to_java_column(genotypes))) assert check_return_type(output) return output